Analogy/Homology

Homologous Traits

Although Humans walk erect on two legs, have a large range of agility and mobility, have the ability to be critical thinkers what do we have in common with a household mouse?

Humans have a skeletal structure that includes the skull, vertebrae, rib cage, clavicle, appendages equipped with joints, hands and feet.

A mouse possesses a large number of the same things, skull, vertebrae, rib cage, clavicle, appendages equipped with joints, hands and feet. The exception with mice is the large quantity of hair on it body (at least we hope), they walk on four legs and are much smaller than a human.

One specific trait that is Homologous between the Human and the mouse is the human arm and the mouse forearm. Structurally they are very similar. They both start with the humerus bone, then the joint (elbow) connects to the Ulna and Radius bone (forearm), there is differentiation in the wrist for the two but still holds similarity as a joint connecting to the small bones of the hands and fingers.

The human arm becomes more complicated it the wrist and hand region due to the higher mobility and uses of the hand. We have dexterity that allows use to manipulate small and large items. We can also carry, squeeze, pinch and grab. Our hands are very useful tools in everyday life. We have a much larger range of movement in our arms as well. This allows us to move more freely in so many activities in a Humans daily life.

Mice on the other hand are limited in their movement. Mice appendages are close to their body as they crawl low to the ground. Mice use their hands to walk on. They are able to manipulate some items with their hand but don't use their "fingers" in the same fashion we do. They don't have independent usage of the fingers as we do.

The common ancestor of the Human and the mouse is the Placental Mammal. Mammals are born live needing their mother"s milk for survival. Prior to birth they share the same oxygen and nutrients.

Mouse limb

Human Limb

Analogous Traits

The platypus is a mammal, covered in fur and is semi aquatic. They are described to have a duck bill, beaver tail and is otter footed.

The duck is a bird, covered in feathers and semi aquatic. They have bills, wings, and multi colored feathers.

What do these two have in common besides bills? They both lay eggs to reproduce. They create and pass life on through the production and delivery of eggs.

These two creatures belong to different classes of animals. Considering the platypus is the only mammal that lays eggs I doubt they share the same ancestry traits. The Platypus is very unique from it's characteristics to the reproduction considering it is a mammal. The duck is the class of the bird and can fly unlike the Platypus. On the other hand both creature are semi aquatic, lay eggs, have webbed feet and "duck" bills so the possibility could be there.

Platypus


Duck

DNA

CCAGTATACCAAGGTAGTGGCCCCACAACTGAACTCTATATCAACCTT

The Inspiration of Charles Lyell

Charles Lyell was a profound Geologist of his day. He was best known for his concepts of uniformitarianism. A concept that our earth is ever evolving in minuet ways but over a span of time has a major impact. Meaning the weather and constant natural elements are what created our present geological landscape and will continue to have an impact on our future. (source; victorianweb.org)

The idea that individuals do not evolve but populations do is an ideal supported by Lyell's theories. He believes that changes occur on a consistent basis but are usually ever so slight. Once you look at the evolution of geological measure over a lengthy period of time you find them to be more profound. It takes time for evolution to take place. This theory supports that environments change and the inhabitants have to adapt. These changes have to be ever so slight because if they become catastrophic species will be eliminated and the it will be more of a struggle to balance out the environment as well as it's inhabitants.

People cannot change their genetics within their own lifetime. When a series of generations have developed, that is when the genetic makeup provide more evidence that they have evolved.

Lyell had a major impact on Darwin's theory of natural selection. Lyell's theory of geological evolution gave Darwin the foundation and process in which he used to investigate his theory. Without the geological evolution there would be less of a need for the natural selection of species. Without environmental change the inhabitants would not have to evolve to survive. There would not be a "Survival of the fittest". It was said Lyell's geological findings are what inspired Darwin to start investigating the theory of evolution.

Lyell and Darwin's ideals did not always have the same intent. Lyell's goals seemed more to support the bible's teachings as Darwin's seemed more to challenge the beliefs taught though the Bible. Darwin's book "On the Origin of Species"  was a threat to the foundations of the church. The theory of disproving the origin of man originally taught in the Bible would crumble the foundation of the church. Elitists thought it was an insult to their upbringing because it questioned what they believed as hundreds of years of teachings and ideals. This slowed Darwin's enthusiasm to publish his works. Darwin gained confidence to publish his book when more authors and scientists were beginning to introduce the idea to the public.

If I were....

If I were on a desert island, the two things I would take would be a large BBQ Bic lighter and my husband. I would want the lighter to assist for a source of heat and cooking capabilities. I would want my husband there because HE believes he could survive in any environment and provide food and shelter. LOL