Human Variation and Race

I chose the environmental stress of the cold. I grew up where it could go as low as -40 degrees so I have experienced the measures it takes to "weather the cold". The cold can have a negative impact on the survival of man.

When there are extreme cold temperatures or long exposure to cool temperatures it can cause severe recreations in your body. The most severe is death by hypothermia. Hypothermia  is a condition that causes abnormally low body temperature, normally dangerously low. It can also cause frostbite, a medical condition that freezes a specific part of the skin. Short term allows the circulation to return to the parts affected. Long term frostbite can cause permanent damage to the exposed skin. The results of pennant damage is removal or if untreated gangrene. This could cause minimal usage of hands and feet. It could also cause an infection in the body.

When you don't have ways to adapt and address the cold it could also limit your general movement. You would want to limit you body to the exposure so it would cause you to hold your body together in a crouched huddling position to try and keep the heat from escaping your body.

The cold can also make you susceptible to getting illnesses. If these illness occurs it is harder to recover if you are still exposed the the cold weather and nothing to shelter you from it. This will also make it more difficult to complete daily tasks. When your ill you get exhausted easily which makes it hard to find the motivation and strength to carry out any necessary actions.

Short-term adaptation of exposure to the cold is the Metabolic Rate of the human body. It has shown to increase in the humans that have constant exposure to the cold climates. The Metabolic rate can increase up to 30% in the winter, even when the body is still. This is a reaction that can also decrease when needed. Also, constant exposure to extreme weather can assist your body into adjusting to the cold and not feeling such an extreme difference.



A Facultative adaptation is called Vasoconstriction. This is when the body's blood vessels and arteries constrict which causes less blood flow. This reduces the radiation of heat and causing the body to retain it's heat. Which keeps your body internally warmer.


The Developmental adaptation is when the humans of a cold region develop short and robust body types. This cause them to retain more heat (layers of protection from the cold). Larger bodied humans tend to be more to insulated by fat. Thus even people from colder states have been known to consume more calories in the winter months. They say that is a response to the cold weather.



The Cultural adaptation of the cold is clothing.  Warm clothing was a reaction of wanting to be mobile in the cold weather. People used furs and leathers to shelter themselves. Nowadays people have clothing with insulation to protect them from the elements.


I think it is important to understand the adaptations of humans to the cold  because if you encounter that type of environment you will know how to survive. There is severe consequences to not being able to protect yourself from the cold, ultimately death. If we all experience a severe climate change there will be a way to survive if you have an understanding of the adaptations to it.

I think knowing how these adaptations have an influence on how we look is important because it gives us a simple understanding as to why we all look different from eachother. It is a mere reaction of our body to the environment we dwell in. Looking at just race doesn't give as much insight to the internal reaction of the human body only a way to be categorized by our appearances.

Language Blog

Part 1:

First conversation occurred without any use of verbal language, writing or sign language (ASL). I felt it was difficult to have a conversation with any detail. I don't know of a way to articulate too many details without speaking or writing. It is like playing Charades. It takes way too long to portrait information to another using this method.

My partner that was attempting to have a conversation with me in this manner was getting frustrated because it was harder to convey anything with real meaningful content. He would try to have a more basic conversation in order to make it easier. Then he started asking more questions so it could be more of a simple reply on my end.

I feel I was more in control of the conversation due to my lack of communication. My partner had to cater to my abilities or inabilities. My partner had control of the subjects and the limits of the topics though.  He would bring up topics or subjects that were easier to convey responses to. He would simplify the information more and more until it seemed to be a comfort level that we could attempt to communicate at. After a few minutes, my partner would just ask me questions that I could basically answer yes or no, with minimal detail.
I think we both had different power in the conversation. I had the power of limitation and he had the power of content as well as topic.

 If my partner and myself represented two different cultures, I believe he would have all the power. He would be able to articulate way more complicated information than I could. He could articulate to larger masses of people. I would only be able to show others basic ideas with a smaller number of people and it might not even be conveyed.

I think a speaking culture would have superiority over a non speaking culture. You can work in mass if your able to communicate need and wants at a easier level. You would be able to communicate details that would be pertinent to many functions as a community and a progressing society. Also cultures believe it is a more dignified way of communication.

I can't think of any modern culture that does not have a way to communicate. Often times there is a lack of communication or misinterpretations due to language barriers. When people are unable to understand each other it can feel like we are on different planets. If you want to compare our communication with children, I could say in the beginning they are unable to speak. We have to start interpreting their cries, their motions and their fussiness. We start learning what they need and want through repetition and knowing their basic needs and wants.

Part 2:

Second part of this assignment I found difficult as well. I am known for being active with my hands when I communicate. I also use a lot of facial expression when I communicate. It was hard to control what I believe to be a natural reaction for me when I communicate. I was distracted by eliminating all the factors I needed to complete this assignment.

My partner understood all the information I was communicating but he was distracted by my lack of emotion and lack of movement. He is use to me portraying myself a certain way so he was anticipating more than just words. He thought it was harder to take me seriously because it was hard to know if I was being sarcastic, silly or serious.

This experiment showed that how we express ourselves physically is almost as important as the words coming from our mouths. Our tone makes people know the emotions behind the content. It's a way of expressing ourselves without having to use all the words. Physical expressions alert us if someone is lying, is uncomfortable, portraying something other than their words, love, respect, kindness and irritation.

Benefits to being able to read people's body language can help you survive by knowing if someone is going to harm you. It can help you gain resources by portraying trustworthy behavior. It can help you reproduce successfully because you are able to portray attraction or love.

I believe there are people that have difficulty reading body language. Generally I believe people that do not possess the ability to read people are often socially awkward. Generally they are easy to spot. They stand too close when people are clearly uncomfortable. They continuously push for a relationship that someone is clearly trying to avoid but be kind.  I believe it is sometimes a positive thing not to read body language because you don't sense all the negative output you may be receiving and can go about being happy. Another positive thing about not being able to read people is if they are good manipulators, sometimes they will use more physical effect to get want they want.

Piltdown Hoax

In the year of 1912, in the small city of Piltdown, a man named Dawson made what seemed to be an amazing discovery. He was considered an amateur archaeologist in the scientific world but was digging through some rubble one day and found what was believed to be the oldest "Human" in England.

Once Dawson made this proclamation, he invited Woodward a leading Archaeologist to assist in this investigation. Then more well known scientists joined the investigation in hopes to be a part of what could be the biggest discovery in connecting the ancestors of the chimpanzee and apes to the Human.

Arthur Keith was very supportive in this discovery because it supported his version of evolution. He believed the human "Big brain" occurred prior to the upright walking. Which is the opposite of what is believed and supported today.

Hinton was a young volunteer Biologist. He also had a hand in this investigation and possibly assisted in creating the fake Primitive Human. He was desperate to make a name for himself in the Scientific World.

People did not want to question this discovery because of the involvement of Woodward. He was very well respected in the science field. People did however question it behind closed doors.

This discovery was believed to be over a million years old. Might even be the oldest in the world. The skull structure was possessing a animal like jaw with human like teeth.

Forty years had past, it was decided to once again test the Piltdown Man's skull. There was a new chemical system in place that can help put a time on the age of the skull. The new technology showed the skull was of an earlier age. Possibly only 100 years old. The skull was made up of a female chimpanzee with filed down teeth. The bones were stained to appear to be extremely aged.

Obviously the members of the scientific community was appalled.  They couldn't believe someone would falsely make such a huge significant discovery. This influenced other scientists because now they were trying to make comparison discoveries believing this was what they were searching for in order to find the connection in their own findings.

When Scientists are worried about making a name for themselves or looking for Scientific prestige unfortunately some are willing to sacrifice truth, integrity and any form of ethics. This can put science into a holding pattern or reproduce inaccurate information. This can make other scientist try to achieve something that doesn't exist and waste a lot of valuable time.

Scientists are continually trying to become more accurate with the information provided on artifacts and fossils. It was extremely beneficial that throughout time they continually tried to answer "How old is the Piltdown Man?" The new technology was used to create a more accurate depiction of age on the skull. It was discovered the skull was fairly new and not of the ancestor of the ape and man.

What can we do to eliminate the human factor in the scientific methods to ensure this type of false information does not happen again?  Nothing. It is humans curiosity that makes science discoveries grow. Accessing and using critical thinking is how the information is discovered. So without "human" factor science would be stagnant.

What can we learn from this discovery? Keep questioning, keep testing, challenging and discovering. One great man's word cannot be taken for fact, it takes some form of a Scientific Method to ensure the information provided is validated.

Analogy/Homology

Homologous Traits

Although Humans walk erect on two legs, have a large range of agility and mobility, have the ability to be critical thinkers what do we have in common with a household mouse?

Humans have a skeletal structure that includes the skull, vertebrae, rib cage, clavicle, appendages equipped with joints, hands and feet.

A mouse possesses a large number of the same things, skull, vertebrae, rib cage, clavicle, appendages equipped with joints, hands and feet. The exception with mice is the large quantity of hair on it body (at least we hope), they walk on four legs and are much smaller than a human.

One specific trait that is Homologous between the Human and the mouse is the human arm and the mouse forearm. Structurally they are very similar. They both start with the humerus bone, then the joint (elbow) connects to the Ulna and Radius bone (forearm), there is differentiation in the wrist for the two but still holds similarity as a joint connecting to the small bones of the hands and fingers.

The human arm becomes more complicated it the wrist and hand region due to the higher mobility and uses of the hand. We have dexterity that allows use to manipulate small and large items. We can also carry, squeeze, pinch and grab. Our hands are very useful tools in everyday life. We have a much larger range of movement in our arms as well. This allows us to move more freely in so many activities in a Humans daily life.

Mice on the other hand are limited in their movement. Mice appendages are close to their body as they crawl low to the ground. Mice use their hands to walk on. They are able to manipulate some items with their hand but don't use their "fingers" in the same fashion we do. They don't have independent usage of the fingers as we do.

The common ancestor of the Human and the mouse is the Placental Mammal. Mammals are born live needing their mother"s milk for survival. Prior to birth they share the same oxygen and nutrients.

Mouse limb

Human Limb

Analogous Traits

The platypus is a mammal, covered in fur and is semi aquatic. They are described to have a duck bill, beaver tail and is otter footed.

The duck is a bird, covered in feathers and semi aquatic. They have bills, wings, and multi colored feathers.

What do these two have in common besides bills? They both lay eggs to reproduce. They create and pass life on through the production and delivery of eggs.

These two creatures belong to different classes of animals. Considering the platypus is the only mammal that lays eggs I doubt they share the same ancestry traits. The Platypus is very unique from it's characteristics to the reproduction considering it is a mammal. The duck is the class of the bird and can fly unlike the Platypus. On the other hand both creature are semi aquatic, lay eggs, have webbed feet and "duck" bills so the possibility could be there.

Platypus


Duck

DNA

CCAGTATACCAAGGTAGTGGCCCCACAACTGAACTCTATATCAACCTT

The Inspiration of Charles Lyell

Charles Lyell was a profound Geologist of his day. He was best known for his concepts of uniformitarianism. A concept that our earth is ever evolving in minuet ways but over a span of time has a major impact. Meaning the weather and constant natural elements are what created our present geological landscape and will continue to have an impact on our future. (source; victorianweb.org)

The idea that individuals do not evolve but populations do is an ideal supported by Lyell's theories. He believes that changes occur on a consistent basis but are usually ever so slight. Once you look at the evolution of geological measure over a lengthy period of time you find them to be more profound. It takes time for evolution to take place. This theory supports that environments change and the inhabitants have to adapt. These changes have to be ever so slight because if they become catastrophic species will be eliminated and the it will be more of a struggle to balance out the environment as well as it's inhabitants.

People cannot change their genetics within their own lifetime. When a series of generations have developed, that is when the genetic makeup provide more evidence that they have evolved.

Lyell had a major impact on Darwin's theory of natural selection. Lyell's theory of geological evolution gave Darwin the foundation and process in which he used to investigate his theory. Without the geological evolution there would be less of a need for the natural selection of species. Without environmental change the inhabitants would not have to evolve to survive. There would not be a "Survival of the fittest". It was said Lyell's geological findings are what inspired Darwin to start investigating the theory of evolution.

Lyell and Darwin's ideals did not always have the same intent. Lyell's goals seemed more to support the bible's teachings as Darwin's seemed more to challenge the beliefs taught though the Bible. Darwin's book "On the Origin of Species"  was a threat to the foundations of the church. The theory of disproving the origin of man originally taught in the Bible would crumble the foundation of the church. Elitists thought it was an insult to their upbringing because it questioned what they believed as hundreds of years of teachings and ideals. This slowed Darwin's enthusiasm to publish his works. Darwin gained confidence to publish his book when more authors and scientists were beginning to introduce the idea to the public.

If I were....

If I were on a desert island, the two things I would take would be a large BBQ Bic lighter and my husband. I would want the lighter to assist for a source of heat and cooking capabilities. I would want my husband there because HE believes he could survive in any environment and provide food and shelter. LOL